Review



1 ig rabbit polyclonal anti gdf15 proteintech  (Proteintech)


Bioz Verified Symbol Proteintech is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    Proteintech 1 ig rabbit polyclonal anti gdf15 proteintech
    1 Ig Rabbit Polyclonal Anti Gdf15 Proteintech, supplied by Proteintech, used in various techniques. Bioz Stars score: 98/100, based on 10433 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/1+ig+rabbit+polyclonal+anti+gapdh+proteintech/GAPDH+Monoclonal+antibody/pmc12557607__mmc1-16-73-77
    Average 98 stars, based on 10433 article reviews
    1 ig rabbit polyclonal anti gdf15 proteintech - by Bioz Stars, 2026-09
    98/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: N 7 -Methylguanosine tRNA modification enhances oncogenic mRNA translation and promotes intrahepatic cholangiocarcinoma progression.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-METTL1 Proteintech Cat# 14994-1-AP Mouse monoclonal anti-EGFR Proteintech Cat# 66455-1-IG Rabbit polyclonal anti-GAPDH Proteintech Cat# 10494-1-AP Rabbit monoclonal anti-WDR4 Abcam Cat# ab169526 Rabbit monoclonal anti-CK19 Abcam Cat# ab52625 Rabbit polyclonal anti-Ki67 Abcam Cat# ab15580 Mouse monoclonal anti-CCNA2 CST Cat# 4656S Rabbit monoclonal anti-CDK6 CST Cat# 13331S Rabbit polyclonal anti-CDK8 CST Cat# 4106S Rabbit polyclonal anti-mTOR CST Cat# 2972S Rabbit polyclonal anti-pmTOR CST Cat# 2974S Rabbit monoclonal anti-AKT CST Cat# 4691S Rabbit monoclonal anti-pAKT CST Cat# 4060S Anti-rabbit IgG HRP-linked Antibody CST Cat# 7074S Anti-mouse IgG HRP-linked Antibody CST Cat# 7076S Rabbit polyclonal anti-beta-Actin Abbkine Cat# a01011 Anti-Digoxigenin-AP Fab fragments Roche Cat# 11093274910 Mouse monoclonal 7- methylguanosine (m7G) MBL International Cat# RN017M Mouse monoclonal anti-puromycin Millipore Cat# MABE343 Biological samples Human intrahepatic cholangiocarcinoma tissue The First Affiliated Hospital of Sun Yat-sen University https://lt.medidata.cn Chemicals, peptides, and recombinant proteins RPMI Medium 1640 basic (1X) GIBCO Cat# C11875500BT Fetal bovine serum GIBCO Cat# A3160801 Penicillin-Streptomycin GIBCO Cat# 15140163 Lipofectamine 3000 Invitrogen Cat# L3000015 Polybrene Solarbio Cat# H8761 Puromycin Solarbio Cat# P8230 Trizol reagent Life technologies Cat# 15596018 Cycloheximide MedchemExpress Cat# HY-12320 MOPS BioFroxx Cat# 1173GR100 MgCl2 Aladdin Cat# M113687 NaCl Aladdin Cat# C111549 TritonTM X-100 Sigma Cat# 78787 RNasin Ribonuclease Inhibitors Invitrogen Cat# 10777-019 Heparin Aladdin Cat# D130947 PMSF Roche Cat# 10837091001 Benzamidine Sigma Cat# 12072 Sodium borohydride (NaBH4) Sigma Cat# 452882 Aniline Sigma Cat# 242284 HEPES-KOH Bestbio Cat# BB-19324 (Continued on next page) e1 Molecular Cell 81, 3339–3355.e1–e8, August 19, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER KCl Aladdin Cat# P112134 Dithiothreitol Aladdin Cat# D104859 Critical commercial assays mirVana miRNA isolation Kit invitrogen Cat# AM1561 Oligo Clean & Concentrator ZYMO Research Cat# D4061 Cell Cycle Assay Kit PI/Rnase staining Dojindo laboratories Cat# C543 RealTM Envision TM Detection System Peroxidase/DAB+,Rabbit/Mouse Dako Cat# K5007 Cell Counting Kit-8 Dojindo laboratories Cat# CK04 Multiplex Small RNA Library Prep set for Illumina Kit New England Biolabs Cat# E7580S PrimeScript RT reagent Kit Takara Cat# RR036A-1 TB GreenTM Premix Ex TaqTM II Takara Cat# RR820A Mouse Tail Direct PCR Kit Foregene Cat# TP-0134 BrdU Cell Proliferation Kit for Flow Cytometry Manual BioLegend Cat# 370704 Dual-Luciferase Reporter Assay System Promega Cat# E1910 Deposited data RNC-seq Data This paper GEO accession number: 161319 m7G-TRAC-Seq Data This paper GEO accession number: 161319 Ribo-seq Data This paper GEO accession number: 161319 Experimental models: Cell lines HuCCT1 Japan Health Sciences Foundation Resources Bank Cat# JCRB0425 RBE Chinese Type Culture Collection Cat# 31800022 Experimental models: Organisms/strains Mouse: C57BL/6Gpt GemPharmatech GemPharmatech: N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt GemPharmatech GemPharmatech: T001475 Mouse: C57BL/6-Mettl1fl/fl Biocytogen EGE-ZLF-009 Mouse: B6.Cg-Speer6-ps1Tg(Alb-cre)21Mgn/J Jackson Laboratory Cat# 003574 Oligonucleotides siRNA targeting 30UTR sequence: METTL1 #1: CCACTGGTGTTCATGACTA Ribobio N/A siRNA targeting 30UTR sequence: METTL1 #2: AGCTGGAATGAGGAATGTA Ribobio N/A siRNA targeting sequence: METTL1 #1: GATGACCCAAAGGATAAGAAA Ribobio N/A siRNA targeting sequence: METTL1 #2: GGATGTGCACTCATTTCGA Ribobio N/A Probe: tRNA-LysCTT:CGACCCTGAGATTAAGAGTC Sangon Biotech N/A Probe: tRNA-LysTTT:TAAAAGTCTGATGCTCTACC Sangon Biotech N/A Probe: tRNAGlyCCC:GTCTCCCACGTGGGAGGCGA Sangon Biotech N/A Probe: U6 snoRNA:TGGAACGCTTCACGAATTTG Sangon Biotech N/A Primers for qPCR analysis see Table S5 TIANYI HUIYUAN N/A (Continued on next page) Molecular Cell 81, 3339–3355.e1–e8, August 19, 2021 e2



    Similar Products

    98
    Proteintech 1 ig rabbit polyclonal anti gdf15 proteintech
    1 Ig Rabbit Polyclonal Anti Gdf15 Proteintech, supplied by Proteintech, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/1+ig+rabbit+polyclonal+anti+gapdh+proteintech/GAPDH+Monoclonal+antibody/pmc12557607__mmc1-16-73-77
    Average 98 stars, based on 1 article reviews
    1 ig rabbit polyclonal anti gdf15 proteintech - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    96
    Proteintech 1 ap rabbit polyclonal anti gapdh proteintech
    1 Ap Rabbit Polyclonal Anti Gapdh Proteintech, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/1+ig+rabbit+polyclonal+anti+gapdh+proteintech/beta+Tubulin+Antibody/pm39739529-525-15-19
    Average 96 stars, based on 1 article reviews
    1 ap rabbit polyclonal anti gapdh proteintech - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    98
    Proteintech ab106793 rabbit polyclonal anti gapdh proteintech
    Ab106793 Rabbit Polyclonal Anti Gapdh Proteintech, supplied by Proteintech, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/1+ig+rabbit+polyclonal+anti+gapdh+proteintech/GAPDH+Monoclonal+antibody/pm39366382-267-35-39
    Average 98 stars, based on 1 article reviews
    ab106793 rabbit polyclonal anti gapdh proteintech - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    Proteintech anti gdi2 proteintech 10116 a ap rabbit polyclonal
    Anti Gdi2 Proteintech 10116 A Ap Rabbit Polyclonal, supplied by Proteintech, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/1+ig+rabbit+polyclonal+anti+gapdh+proteintech/GAPDH+Monoclonal+antibody/pm38382624-165-6-7
    Average 98 stars, based on 1 article reviews
    anti gdi2 proteintech 10116 a ap rabbit polyclonal - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    Proteintech antibody anti cpeb4 rabbit polyclonal proteintech
    Antibody Anti Cpeb4 Rabbit Polyclonal Proteintech, supplied by Proteintech, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/1+ig+rabbit+polyclonal+anti+gapdh+proteintech/GAPDH+Monoclonal+antibody/10__7554_slash_elife__90116-265-91-96
    Average 98 stars, based on 1 article reviews
    antibody anti cpeb4 rabbit polyclonal proteintech - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    97
    Proteintech application gapdh rabbit igg proteintech 10494 1 ap wb bmi 1 mouse igg2b proteintech 66161 1 ig wb
    Application Gapdh Rabbit Igg Proteintech 10494 1 Ap Wb Bmi 1 Mouse Igg2b Proteintech 66161 1 Ig Wb, supplied by Proteintech, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/1+ig+rabbit+polyclonal+anti+gapdh+proteintech/GAPDH+Polyclonal+antibody/pmc10258013__aging___15___204742___s001-4-5-9
    Average 97 stars, based on 1 article reviews
    application gapdh rabbit igg proteintech 10494 1 ap wb bmi 1 mouse igg2b proteintech 66161 1 ig wb - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    98
    Proteintech rabbit polyclonal anti pink1 proteintech rrid
    Rabbit Polyclonal Anti Pink1 Proteintech Rrid, supplied by Proteintech, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/1+ig+rabbit+polyclonal+anti+gapdh+proteintech/GAPDH+Monoclonal+antibody/pmc09638004__mmc9-229-54-57
    Average 98 stars, based on 1 article reviews
    rabbit polyclonal anti pink1 proteintech rrid - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    96
    Proteintech paper n a rabbit polyclonal anti gapdh proteintech
    Paper N A Rabbit Polyclonal Anti Gapdh Proteintech, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/1+ig+rabbit+polyclonal+anti+gapdh+proteintech/TOM20+Antibody/pm34428398-255-60-65
    Average 96 stars, based on 1 article reviews
    paper n a rabbit polyclonal anti gapdh proteintech - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Proteintech 1 ig rabbit polyclonal anti gapdh proteintech
    1 Ig Rabbit Polyclonal Anti Gapdh Proteintech, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/1+ig+rabbit+polyclonal+anti+gapdh+proteintech/EGFR+Antibody/pm34352206-263-17-21
    Average 96 stars, based on 1 article reviews
    1 ig rabbit polyclonal anti gapdh proteintech - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results